No. Primer Name Sequence Size (mer) Tm °C Remarks

1

M13/pUC

5'AGCGGATAACAATTTCACACAGGA3'

24

70

reverse primer(-48)

2

M13/pUC

5'AACAGCTATGACCATGATTACG3'

22

55

reverse primer(-21)

3

M13/pUC

5'TGTAAAACGACGGCCAGT3'

18

57

uviversal primer(-20)

4

M13/pUC

5'GTTTTCCCAGTCACGACGTTG3'

21

60

universal primer(-40)

5

T3

5'GCGCGAAATTAACCCTCACTAAAG3'

24

69

T3

6

T7

5'TTAATACGACTCACTATAGG3'

20

62

T7

7

SP6

5'CCAAGCTATTTAGGTGACAC3'

20

55

SP6

8

SP6A

5'GCATTTAGGTGACACTATAG3'

20

64

for pcDNA3 ( reverse)

9

BGH rev

5'TAGAAGGCACAGTCGAGG3'

18

55

for pcDNA3 (reverse)

10

pET

5'TAGGGGAATTGTGAGCGGATAAC3'

23

62

for pET

11

T7 Terminator

5'GCTAGTTATTGCTCAGCGGT3'

20

68

for pET

12

pGEX5

5'GGGCTGGCAAGCCACGTTTGGTG3'

23

79

5'

13

pGEX3

5'CCGGGAGCTGCATGTGTCAGAGG3'

23

79

3'

14

POLY-T

5'TTTTTTTTTTTTTTTTTTTTTTV3'

23

53

for sequencing down stream poly-T regions

15

POLY-A

5'AAAAAAAAAAAAAAAAAAAAAB3'

23

53

for sequencing down stream poly-A regions

16

pJET for

5'CGACTCACTATAGGGAGAGCGGC3'

23

77

pJET forward

17

pJET rev

5'AAGAACATCGATTTTCCATGGCAG3'

24

70

pJET reverse